Skip to main content

Table 1 Information on primer set used in this study

From: Occurrence and diet analysis of sea turtles in Korean shore

Target Primer Sequence (5′– 3′) Reference
Algae (16S) PSf GGGATsTAGATACCCCWGTAGTCCT Stiller and McClanahan 2005
Ur TACGGYTACCTTGTTACGACTT
Uf GAGAGTTTGATCCTGGTCAG
PSr AGGACTACWGGGGTATCTAATCCC
Fish (12S) MiFish-E-F GTTGGTAAATCTCGTGCCAGC Miya et al. 2015
MiFish-E-R CATAGTGGGGTATCTAATCCTAGTTTG
MiFish-U-F GTCGGTAAAACTCGTGCCAGC
MiFish-U-R CATAGTGGGGTATCTAATCCCAGTTTG
Animal (COI) LCO1490 GGTCAACAAATCATAAAGATATTGG Vrijenhoek 1994
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA